EST details — SGN-C76501

Search information 
Request: 76501Match: SGN-C76501
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C76501Clone name: cLES-18-D3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179149 is on microarray TOM1: SGN-S1-1-6.1.2.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179149 [TUS-31-A3] Trace: SGN-T185085 EST: SGN-E372628 Direction: 3' Facility: INRA
Clone: SGN-C179149 [TUS-31-A3] Trace: SGN-T185086 EST: SGN-E372629 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289128Length: 466 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289128 [] (trimmed) TTTTTTTTAAAAAGTTAACAAAGATAGCACTACCGGACAAATACAAAAGTGCAGTTAGATATATCTGGGGAAAAGAAGACCACAGAACGGCACTT
GCTACTTGCTATAATGTTAAACCCATTTTTCATCATCAACATTAAAAACCTAATTAAACAAGACTTAAAGTTTCGGTCTAGGAGGATATAACCAG
AAAGAGTTAACAAGCAAAGCCATTATGGTAATAAACAAAATTGGAAATTTAAGACGAGCGTAAGCTAAACTCTTCTTAGGTTGCAATGGCATGCC
TTTGGATGATCTGAAAACCACTTTTCCTAGCGAAGCCAGAGACAATGCAAGTCATTCCTTTCTTCACAAGAAAATAAAATTGCATGTTCTGTGAT
GCCGATCAGCTAATGGCCACTAAGAAGTGATATGTAAGTCACTAAATGGTTGTATGGAGCGCTGTCTGGCCTTAGTTTCATCATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289128] SGN-U572278 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101570 [Download] [View] Facility Assigned ID: TPSCS14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5