Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C76677

Search information 
Request: 76677Match: SGN-C76677
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C76677Clone name: cLES-18-M21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179202 is on microarray TOM1: SGN-S1-1-1.3.2.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179202 [TUS-31-C8] Trace: SGN-T185271 EST: SGN-E373829 Direction: 3' Facility: INRA
Clone: SGN-C179202 [TUS-31-C8] Trace: SGN-T185272 EST: SGN-E373830 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289235Length: 447 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289235 [] (trimmed) GGATTTTTCGCATTGTATTTAGCTATGGCTCCAGCTAAAGTGGACTTAACAAAAAAGAAAGACCCCAAAGCCCACGCTGTCAAGGCTGCCAAGGC
TGTTAAGTCTGGATCAACCTTTAAGAAGAAGTCAAGTCTGATAAGGGCAAAAGTTACTTTCCATCGACCTAAGACATTGAAGAAGGATAGGAATC
CCAAGTACCCTCGCATTAGTGCACCTGGAAGGAACAGACTTGATCAGTACCAGGTTCTAAAATGTCCTCTTACGACCGAGTCTGCAATGAAGAAG
ATTGAGGACAACAATACCCTTGTTTTCATTGTTGACATTCATGCTGACAAGAAGAAGATAAAAGATGCGGTGAAGAAAATGTATGACATCCAGAT
CAAGAAAGTCAATACCTTGATCAGGCCTGATGGGACAAAGAATGCTTATGTGAGGATGACACCCGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289235] SGN-U577327 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101677 [Download] [View] Facility Assigned ID: TPSCQ83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0208 Quality Trim Threshold: 12.5