EST details — SGN-C77144

Search information 
Request: 77144Match: SGN-C77144
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77144Clone name: cLES-20-B18
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184458 is on microarray TOM1: SGN-S1-1-1.2.16.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184458 [TUS-44-N8] Trace: SGN-T198442 EST: SGN-E397116 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290610Length: 552 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E290610 [] (trimmed) CAAGATGGATAAGAGTATGATCGGAGACTTGGATTCACTTCCTGAAGCAGATAAGATCAGAATGGCAGCCATGATTGAGCAGCTCCAAGTTCGTG
ACAGCTTGAGAATGTATAATTCTCTGGTCGAAAGATGTTTCACGGACTGTGTAGACAGTTTCAAACGCAAAACTTTAGACAAACAAGAGGAGACC
TGTGTCCGACGATGTGCTGAGAAGTTCTTGAAGCATTCTATGCGTGTAGGACTGAGATTTGCAGAGCTTAACCAAGGTGCACCAACACCAGACTA
AGACGCTTCTGTTATGTGCCTGCAATTCAATTTCTCATTATTGTTTATTGTGGGTTAATCAACAAGGACAAGTAGTGGAAGTTCCTTATTTTGGA
AAGTCAACAGCTCTCCTCGTTGTTATTGGTAAAATGTACTTCTACAGTTAAATTATTAGAAACTTGAATAGTAGAACTGGATCCTGTAACTGATT
GCAGGCCACTTGCTGTTACGATAGCATTCTTTTGTTGTGACGTTCTAGTAAAATAATGTGGTATTCAACTTCATCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290610] SGN-U584323 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102289 [Download] [View] Facility Assigned ID: TPSDB09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0008 Quality Trim Threshold: 12.5