Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C77160

Search information 
Request: 77160Match: SGN-C77160
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77160Clone name: cLES-20-C14
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184460 is on microarray TOM1: SGN-S1-1-7.2.16.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184460 [TUS-44-N10] Trace: SGN-T198443 EST: SGN-E397117 Direction: 3' Facility: INRA
Clone: SGN-C184460 [TUS-44-N10] Trace: SGN-T200003 EST: SGN-E398677 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290525Length: 404 bp (1251 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290525 [] (trimmed) AGCTGGACCGGTGACAAACCTCGTCAAAAAAACGGTGAAGACATGGGTAATTTCTACTCAGCCGGTTTAGATCCGATTTTTTACTGCCACCATGC
CAATGTGGACAGGATGTGGAATGAATGGAAATTAATTGGCGGGAAAAGAAGGGATTTAACAGATAAAGATTGGTTGAACTCTGAATTCTTTTTCT
ACGATGAAAATCGTAACCCTTACCGTGTGAAAGTCCGTGACTGTTTGGACAGTAAAAAAATGGGATTCGATTACGCGCCAATGCCCACTCCATGG
CGTAATTTTAAACCAATCAGAAAGTCATCATCAGGAAAAGTGAATACAGCGTCTATTGCACCAGTTAGCAAGGTGTTGCCATTGGCGAAGCTGGA
CCGTGCGATTTCGTTCTCTATCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290525] SGN-U579941 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102204 [Download] [View] Facility Assigned ID: TPSCZ19THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5