EST details — SGN-C77190

Search information 
Request: 77190Match: SGN-C77190
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77190Clone name: cLES-20-D24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185241 is on microarray TOM1: SGN-S1-1-2.2.11.3
See unigene SGN-U582049 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C185241 [TUS-46-N23] Trace: SGN-T199064 EST: SGN-E397738 Direction: 5' Facility: INRA
Clone: SGN-C185241 [TUS-46-N23] Trace: SGN-T199116 EST: SGN-E397790 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290445Length: 582 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290445 [] (trimmed) TTTGAAAATTTCTCCCTATATTTTTTTCCCTTCTACTGCTATGGGTTTGTCTCTGTTTCTCCACTTGCCCAACCTTGATGAAACGGTGTCGTGTG
AGTACAGAGACTTGCCTGACCCGATTCAGATTCCGGGTTGTACTCCGATCCACGGTAAGGATCTACTTGACCCGGTTCAAGACCGGAATGATGAA
TCCTATAAATGGCTTCTTCATCATGCGAAGAGGTATGGAATGGCAGAAGGGATAATAGTGAACAGTTTTAAGGAATTGGAAGGAGGAGCCATTGG
CGCTCTACAGAAGGATGAACCGGGTAAACCAACCGTTTACCCGGTTGGCCCGCTTATTCAGATGGATTCGGGTAGTAAGGTTGACGGGTCGGAGT
GTATGACGTGGCTGGATGAACAGCCGCGTGGCTCTGTGTTATACATATCGTACGGTAGTGGTGGGACCCTATCTCATGAGCAACTAATTGAAGTT
GCAGCAGGGTTGGAAATGAGTGAACAAAGGTTCTTGTGGGTAGTTAGATGCCCTAATGACAAAATAGCTAACGCTACTTTTTTTAATGTCCAAGA
TTCAACGAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290445] SGN-U582049 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102124 [Download] [View] Facility Assigned ID: TPSDB24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5