Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C77240

Search information 
Request: 77240Match: SGN-C77240
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77240Clone name: cLES-20-F5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179284 is on microarray TOM1: SGN-S1-1-7.2.2.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179284 [TUS-31-F18] Trace: SGN-T185642 EST: SGN-E373504 Direction: 3' Facility: INRA
Clone: SGN-C179284 [TUS-31-F18] Trace: SGN-T185643 EST: SGN-E373505 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290571Length: 282 bp (1104 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290571 [] (trimmed) ATCATCAGGAAACCAACCAAAATTCACTCGAGATCTCGTGCTCGCCGAATGAAGGAGGCCAAGAGGAAAGGCCGTCACTCTGGATATGGTAAGCG
CAAAGGTACCAGGGAGGCTAGACTGCCTACCAAGGTGCTTTGGATGAGGAGATTGAGAGTCCTCAGGCGTTTGCTTCGCAAGTATAGGGAATCAA
AGAAGATTGACAAACACATGTATCATGACATGTACATGAAGGTGAAGGGTAATGTTTTCAAGAACAAGCGTGTGCTGATGGAAAATATCCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290571] SGN-U578709 Tomato 200607 Build 2 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102250 [Download] [View] Facility Assigned ID: TPSDA27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5