EST details — SGN-C77253

Search information 
Request: 77253Match: SGN-C77253
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77253Clone name: cLES-20-G18
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179288 is on microarray TOM1: SGN-S1-1-3.2.2.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179288 [TUS-31-F22] Trace: SGN-T185561 EST: SGN-E373423 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290536Length: 453 bp (1205 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E290536 [] (trimmed) CGGGCACTCCCCCGTGAAGTTGATCCTGTTGTGTACAACATGCTTCATGAAGATCCTGGCAACATCAGTTACTCTGCCGTGGGTGGACTGTCAGA
TCAGATCAGGGAGCTGAGAGAATCCATTGAGTTACCTCTAATGAACCCTGAGCTTTTCCTCCGGGTTGGGATTAAGCCTCCAAAGGGTGTTCTTC
TCTACGGGCCTCCTGGAACAGGCAAGACATTGTTAGCCAGGGCAATCGCTAGCAACATAGATGCCAATTTCTTAAAGGTTGTATCAAGTGCCATT
ATTGATAAGTACATTGGTGAGAGTGCAAGATTAATTCGGGAAATGTTTAACTATGCGCGTGATCACCAACCTTGCATCATATTCATGGATGAGAT
AGATGCAATTGGTGGACGTCGTTTTAGTGAGGGAACCAGTGCAGACCGTGAAATCCAAAGAACGCTCATGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290536] SGN-U566414 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102215 [Download] [View] Facility Assigned ID: TPSCZ45THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5