EST details — SGN-C77303

Search information 
Request: 77303Match: SGN-C77303
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77303Clone name: cLES-20-I23
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179305 is on microarray TOM1: SGN-S1-1-2.3.2.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179305 [TUS-31-G15] Trace: SGN-T185036 EST: SGN-E372579 Direction: 3' Facility: INRA
Clone: SGN-C179305 [TUS-31-G15] Trace: SGN-T185037 EST: SGN-E372580 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290333Length: 571 bp (834 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290333 [] (trimmed) TTCACACAAAATTACTACAATGGCTGGGAAAATGAGCATTGTCTTGTTTGTTCTTTTGGTGGTTTTCCTGACTCAAAATCAGGTTTCAAGGGCCA
ACATTATGCGTGATGAGCAGCAGCAACAACAGAGAAATAACCAACTGTATGGTGTTAGTGAGGGAAGACTCCATCCTCAAGATTGTCAACCAAAA
TGCACGTTCCGGTGTTCAAAGACATCGTATAAGAAGCCGTGTATGTTTTTCTGCCAGAAATGCTGTGCAAAGTGTTTGTGTGTTCCTGCTGGTAC
CTATGGCAATAAGCAAAGTTGCCCTTGCTACAATAACTGGAAGACCAAAAGAGGTGGCCCAAAGTGCCCATGATCATCCATATTGTATTAAAATG
TGACTGCAGACACCCAACTTCTGTCAAATCTAGTAGTATTAATTAATTAATCAACACTTGTTGTCTCAAGTGGTGTATTAGCTAGTAATGTTAGG
TCCCAATTATATAGAAGAAGATTGGGCTAGCTACAAGTACAATAGCATGGTTATGATTATGCAGCTATTTTTGTGAGACTTATTTTATATTATTA
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290333] SGN-U578615 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102012 [Download] [View] Facility Assigned ID: TPSCY60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0133 Quality Trim Threshold: 12.5