EST details — SGN-C77373

Search information 
Request: 77373Match: SGN-C77373
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77373Clone name: cLES-20-L5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183473 is on microarray TOM1: SGN-S1-1-2.1.2.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183473 [TUS-42-E7] Trace: SGN-T195480 EST: SGN-E394154 Direction: 3' Facility: INRA
Clone: SGN-C183473 [TUS-42-E7] Trace: SGN-T195481 EST: SGN-E394155 Direction: 5' Facility: INRA
Clone: SGN-C183473 [TUS-42-E7] Trace: SGN-T195481 EST: SGN-E399139 Direction: 5' Facility: INRA
Clone: SGN-C183473 [TUS-42-E7] Trace: SGN-T199403 EST: SGN-E399138 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290590Length: 314 bp (1426 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290590 [] (trimmed) GAAACATGGCTCCAAAGGGCAAGGTCATCAGTTGCAGAGCTGCTGTAGCGTATGGTCCAGGGCAGCCGTTGGTGGTAGAACAAGTGCAGGTAGAT
CCACCTCAGAAAATGGAGGTCCGAATTAAGATTCTCTTTACTTCCATCTGTCACACGGATCTCAGTGCTTGGAAAGGCGAGAGCGAAGCTCAACG
AGCTTATCCTCGAATTCTGGGACATGAAGCATCGGGAGTGGTGGAGAGCGTGGGAGAAGGTGTAATTGACATGAAAGAGGGAGATCAAGTCGTAG
CGATTTTCAATGGTGAATGCGGAGAGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290590] SGN-U581714 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102269 [Download] [View] Facility Assigned ID: TPSDA63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5