EST details — SGN-C7771

Search information 
Request: 7771Match: SGN-C7771
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C7771Clone name: cLEC-40-D15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174264 is on microarray TOM1: SGN-S1-1-3.1.16.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209993Length: 319 bp (1710 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209993 [] (trimmed) TGGCTAATCTGCCAAAAAGCCAAATATTATTTATTTCCAAAAAATAGGACTCCATATCACTGATCTGATCTTCATAATCAATTAGATAATCTCTA
AAACACTATCTTTCTTGAATATATATATAGATTTGGAATTTTGAATACACCATTTTTTTTTAACAAAATATTTGGAGAGAAACAATGATGCAGTT
TTCAGTTCACAGAGTGAAGAAACTAAGGTCTTTGACTCCTGGTATTTTTGCTGTCGCTAATCATCACTTTTCAGTTGCTACGGAATCCTCATGGA
AGCATCGAACTTCCCTCAGAGTTCCAAATTTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209993] SGN-U567272 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32057 [Download] [View] Facility Assigned ID: TCAGC20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0260 Quality Trim Threshold: 14.5