EST details — SGN-C78378

Search information 
Request: 78378Match: SGN-C78378
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78378Clone name: cLES-5-H24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178964 is on microarray TOM1: SGN-S1-1-7.1.2.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178964 [TUS-30-I10] Trace: SGN-T184520 EST: SGN-E371906 Direction: 3' Facility: INRA
Clone: SGN-C178964 [TUS-30-I10] Trace: SGN-T184521 EST: SGN-E371907 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285855Length: 507 bp (905 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285855 [] (trimmed) TGGAGTTTCTTCTTCTTCGTTAGAGACATCAATCACCAGGTAACTTTATAGACAACAAAAATGGCCGATTCACGTGAAGAAAATGTGTACATGGC
CAAGCTGGCTGAACAGGCTGAGAGGTATGAGGAAATGGTTGAGTTTATGGAGAAGGTTGCAAAGGTAGATGTTGAAGAGCTGACTGTGGAAGAAA
GGAATCTTCTTTCTGTGGCTTACAAGAATGTCATTGGTGCAAGAAGGGCTTCGTGGAGGATAATATCTTCAATTGAGCAGAAAGAGGAGAGCCGT
GGAAATGAAGACCATGTTAGCAGCATTAAAGAATATAGAGCCAAAATTGAGGCTGAGCTCAGCAAGATATGTGATGGGATTTTGAGCCTTCTCGA
ATCCCATTTAGTACCATCAGCCTCAACAGCCGAGTCCAAAGTGTTTTACTTGAAGATGAAAGGTGATTACCATAGGTACTTGGCTGAGTTTAAGA
CAGGGGCAGAGAGGAAAGAAGCTGCAGAGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285855] SGN-U578251 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98338 [Download] [View] Facility Assigned ID: TPSAT48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5