EST details — SGN-C78798

Search information 
Request: 78798Match: SGN-C78798
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78798Clone name: cLES-6-M3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179098 is on microarray TOM1: SGN-S1-1-1.2.2.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179098 [TUS-30-N24] Trace: SGN-T184894 EST: SGN-E372102 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286949Length: 325 bp (846 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E286949 [] (trimmed) ATAATATGCTTCGGGGAGGGGCACTTCTATCCTTGATGAGGATGGCATCAACTTTGCATCATGGGAAGAATATTCTATTGAAGGCCCTTTTGACC
CATTTGAGTGTCGTGGGAGCCCCTCGGGATCATACATGGAGGAGTTCCGAAGCAGAACCCCTGCTGTTCGATACGATTCATTGTGTTCTAATGAC
CCTACACAAGAATGCGTGGTATGTCTGGCAGAGTTCAAACATGACCAGGAGATAAACTGCCTCTCATGTGGGCACGTTTTTCATAAGCTGTGTCT
CGAGAAATGGCTAAAGAATTGGAATGTCACCTGCCCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286949] SGN-U581929 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98401 [Download] [View] Facility Assigned ID: TPSAU74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0345 Quality Trim Threshold: 14.5