EST details — SGN-C79374

Search information 
Request: 79374Match: SGN-C79374
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C79374Clone name: cLES-8-L2
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184310 is on microarray TOM1: SGN-S1-1-5.4.16.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184310 [TUS-44-H4] Trace: SGN-T198391 EST: SGN-E397065 Direction: 3' Facility: INRA
Clone: SGN-C184310 [TUS-44-H4] Trace: SGN-T198392 EST: SGN-E397066 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288669Length: 426 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288669 [] (trimmed) CTGCAGTGTAATGGTAGAGTATTTTGCTTAGATGATGAATCTGGGGTGCACCGATTATGGCTGCCCGACGAATCCTCCCCTGGATTGGCAATGTC
TAGAGCCTTCGGGGACTATTGCGTGAAAGATTTTGGTCTAATTTCAGTGCCTGACGTGACACAAAGGCATATCACAAGCAAAGACCAATTTGTTG
TGCTGGCAACAGATGGGGTATGGGATGTTATATCGAATGAAGAGGCTGTAGAAATTGTATCTGAAACTCCAGATAGGGCAAAAGCAGCCAAGCAT
CTTGTTCAATGTGCTGTTCGTGCTTGGAAACGTAAGAGGAGAGGGATAGCTGTAGATGATATTTCAGCCATTGTACTCTTCTTTCTTTCTAAGCA
TTTCTGTCAGCATATTTACCCTGTAACTACTCCAAAATAAGAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288669] SGN-U578645 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99189 [Download] [View] Facility Assigned ID: TPSBF61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0116 Quality Trim Threshold: 12.5