EST details — SGN-C79978

Search information 
Request: 79978Match: SGN-C79978
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C79978Clone name: cLET-10-N19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184725 is on microarray TOM1: SGN-S1-1-6.1.14.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184725 [TUS-45-I11] Trace: SGN-T198490 EST: SGN-E397164 Direction: 3' Facility: INRA
Clone: SGN-C184725 [TUS-45-I11] Trace: SGN-T198491 EST: SGN-E397165 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290763Length: 519 bp (650 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290763 [] (trimmed) GGTTTGTGGGGATATACACGGCCAATTTCATGATCTAATGAAACTTTTCCACACTGGTGGTCATGTGCCAGAGACAAATTACATCTTTATGGGAG
ATTTTGTTGATCGTGGATACAATAGTCTCGAAGTTTTCACAATTTTATTGCTCCTTAAAGCAAGATATCCAGCAAACATTACACTTTTACGCGGG
AACCATGAAAGCAGGCAGCTAACTCAGGTCTATGGATTCTATGATGAATGCCAAAGGAAGTATGGAAATGCAAATGCTTGGCGGTATTGCACTGA
CGTATTTGACTATCTGACTCTCTCGGCAATTATAGATGGAACAGTACTATGTGTCCATGGTGGCCTTTCTCCGGATGTTAGGACTATTGATCAGA
TCAGGGTCATTGATCGTAATTGTGAAATTCCGCATGAAGGGCCTTTTTGTGATCTTATGTGGAGTGATCCTGAAGAGATTGAAACATGGGCAGTA
AGTCCTCGAGGAGCAGGTTGGCTGTTTGGATCCAGGGTTACCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290763] SGN-U570164 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104932 [Download] [View] Facility Assigned ID: TMEBM82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5