Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C80025

Search information 
Request: 80025Match: SGN-C80025
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80025Clone name: cLET-11-A2
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179604 is on microarray TOM1: SGN-S1-1-7.4.1.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179604 [TUS-32-D2] Trace: SGN-T186203 EST: SGN-E372722 Direction: 3' Facility: INRA
Clone: SGN-C179604 [TUS-32-D2] Trace: SGN-T186204 EST: SGN-E372723 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292647Length: 238 bp (760 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292647 [] (trimmed) AGTTAAAGTTCTCTAGAATAAATCATGGCTGCCCTCTCCTCCACCATTTTCATATTTTCCCTTCTAATTTTGGCCACATTCACTAATGGTTGTGG
TCCATGTGAGCCAAAGCCTCACCCAACACCAAAAGCACCCCCAGTGAACCCTTATTGTCCAAAGGACACATTGAAGCTTGGTGTTTGTGCTGACC
TACTTGGCCTTGTAAATGTTGCAATTGGTAGCCAAGTGACAACCCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292647] SGN-U583120 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105110 [Download] [View] Facility Assigned ID: TMEBP01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0271 Quality Trim Threshold: 14.5