EST details — SGN-C80114

Search information 
Request: 80114Match: SGN-C80114
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80114Clone name: cLET-11-E24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179641 is on microarray TOM1: SGN-S1-1-2.1.1.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292663Length: 417 bp (767 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292663 [] (trimmed) TGGCATGCCCGGAGGCTTTCCTGGTGGCATGCCCGGATTTCCTGGTGGCATGCCCGGAGGTTTTCCTGGTGGCATGCCTGGAGGCTTTCCAGGTG
GCATGCCCGGAGGCTTTCCAGGGGGTATGCCTGGGTCTGCACCTGGAGGAATGCCCGGAGGCATGCCTGGGGCTGCACCTGGAGGAATGCCCGGT
AACATGGACTACAGCAAAATACTGAATGACCCTGAATTAATGGCGGCATTCAAGGATCCAGATGTCATGGCTGCACTGCAAGATGTGATGAAGAA
CCCAGCTAATTTGGCCAAGCATCAAGGAAATCCTAAGATTGCTCCTATTATTGCAAAAATGATGGGCAAGTTTGCTGGAAATAATTGAGAGCTTT
TGGGATTTTGTCCGTAAGAATTTCTAGAGTTTGATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292663] SGN-U573579 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105126 [Download] [View] Facility Assigned ID: TMEBP36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0096 Quality Trim Threshold: 12.5