EST details — SGN-C80273

Search information 
Request: 80273Match: SGN-C80273
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80273Clone name: cLET-11-L7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179709 is on microarray TOM1: SGN-S1-1-6.4.1.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179709 [TUS-32-H11] Trace: SGN-T186064 EST: SGN-E372911 Direction: 3' Facility: INRA
Clone: SGN-C179709 [TUS-32-H11] Trace: SGN-T186065 EST: SGN-E372912 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292729Length: 534 bp (827 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292729 [] (trimmed) GCCAAAAACAAAGTAAAAAATTAAACAGTGTTTTTTAAAAAAAAAGAATTTTTGATCAAAGATGGCACAATACGGCAATCAAGACCAAATGCGCA
AGACTGATGAATATGGAAACCATGTCCAAGAAACAGGAGTCTATCAAGGTACCGGTACTGGCGGTATGATGGGGGGCACGGGTACTGGCGGTATG
ATGGGGGGCACTGGTGGAGAATATGGAACTCAAGGCATGGGTACTGGTACTCATCACCATGAGGGGCAACAGCAGCTTCGTCGATCCGACAGCTC
TAGCTCGTCGGAGGATGATGGAGAAGGTGGGAGGAGAAAGAAGGGTTTGAAGGAGAAGATAATGGAGAAGATGCCTGGACAACATGAAGGTGAGT
ATGGACAAACAACAGGTGAAGAGAAGAAAGGAATGATGGACAAAATCAAGGACAAGATCCCTGGGATGCATTGAACACCTTTGTTTTCATCTCCA
TCTTATCTTATGAATAAATAAGGTAGTGCTTGATTCTATTTCATGCACTAATTAGTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292729] SGN-U581493 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105192 [Download] [View] Facility Assigned ID: TMEBQ64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5