Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C80658

Search information 
Request: 80658Match: SGN-C80658
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80658Clone name: cLET-13-A19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179749 is on microarray TOM1: SGN-S1-1-6.2.1.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179749 [TUS-32-J3] Trace: SGN-T186157 EST: SGN-E373004 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293869Length: 214 bp (895 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E293869 [] (trimmed) TACTCCGGAAGTATTATTAGAAAAGGAGGAAAGTGCTTTTTCTAGGATGGTTCAGAGTACAGGAGCTGCAAATGCTGAATACTTACGAAGCTTAG
TCATAGGAGGGGGAGAGGGAAACAGTGTGGTGAACGATCAACAGCTAGATGGGAAAAGGAGGGGGCTTGCCTCTTCACGTGGGAGTGCTGCAGCA
CAGTATGCAATATGTTTTACACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293869] SGN-U585936 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105712 [Download] [View] Facility Assigned ID: TMEBW10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0113 Quality Trim Threshold: 14.5