EST details — SGN-C80683

Search information 
Request: 80683Match: SGN-C80683
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80683Clone name: cLET-13-B24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183681 is on microarray TOM1: SGN-S1-1-2.1.1.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195502 EST: SGN-E394176 Direction: 3' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195970 EST: SGN-E394644 Direction: 3' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195971 EST: SGN-E394645 Direction: 5' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T199410 EST: SGN-E398084 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294158Length: 542 bp (924 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294158 [] (trimmed) CTTTACTGAGGATGGATTGCTTTATGTCGTTGACAGGATCAAAGAGCTCATCAAGTACAAAGGTTTTCAGGTTGCACCAGCAGAGCTTGAAGGTC
TACTTGTTTCTCATCCTGAAATATTAGATGCTGTTGTTATCCCGTTTCCTGATGCTGAGGCTGGTGAGGTTCCGGTTGCATATGTTGTTCGCTCT
CCCAATAGCTCTCTGACTGAAGAAGATGTTCAAAAGTTCATTGCGGATCAGGTTGCACCTTTCAAAAGATTGAAGAAGGTGACATTCATAAACAG
TGTTCCCAAGTCAGCTTCTGGGAAAATCCTAAGAAGAGAACTAATCGATAAGGTTCGTTCAAAAATATAAGATTTTTACCCGATACCTGTGCTGG
TGGGAGCTAGCAAGTACGTGTAGATTTTGTCAAGGTGTACACAAACTGACTCACACTATGGTTATATTTTTTTATTACAAACTAAGTATTGGTAA
GATTTGCATAGTTTGCTCATTATATGTTAAAAGCACATCCATCTACTGGGTATTTTTTTTTTTTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294158] SGN-U584022 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106001 [Download] [View] Facility Assigned ID: TMEBZ12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5