Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C80772

Search information 
Request: 80772Match: SGN-C80772
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80772Clone name: cLET-13-F3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182147 is on microarray TOM1: SGN-S1-1-8.2.10.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182147 [TUS-38-N1] Trace: SGN-T194726 EST: SGN-E393400 Direction: 3' Facility: INRA
Clone: SGN-C182147 [TUS-38-N1] Trace: SGN-T199331 EST: SGN-E398005 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293961Length: 438 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293961 [] (trimmed) TTTCAAAAGTATATTACGAAGGGATATGTCTCTGAGACTGAATCTGGAAAGAGACTTGCTCAGGTTGTGAGTGATCCAAGCTTGACAAAATCAGG
TGTCTACTGGAGCTGGAACAAAGACTCAGCTTCTTTCGAAAACCAGTTGTCCGAAGAAGCAAGTGATGCAGAGAAAGCGCGTAAAGTGTGGGAAG
TCAGTGAGAAACTCGTTGGTTTGGCTTAAATTTTGAACTAACCTTAGTCATCGTCGATGAAAACAGGAAAAATGACTTCGCGAGTGAGAATTTGT
AACCGAAATTTCTAGGATGTTGTAAAGAGAAGTGTCATTGTAGTTAGGATTGAAAATAAAGATCACTCAACTTGTTTTGTTTTGTGTTTGGAAAA
TGTCACTAATTTGCCTTTGAAGTTAAATGAAGTGATGGTTCATGAGCATTGTTCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293961] SGN-U580321 Tomato 200607 Build 2 88 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105804 [Download] [View] Facility Assigned ID: TMEBY26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0034 Quality Trim Threshold: 12.5