EST details — SGN-C80865

Search information 
Request: 80865Match: SGN-C80865
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80865Clone name: cLET-13-J5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179807 is on microarray TOM1: SGN-S1-1-4.4.1.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179807 [TUS-32-L13] Trace: SGN-T186169 EST: SGN-E373016 Direction: 3' Facility: INRA
Clone: SGN-C179807 [TUS-32-L13] Trace: SGN-T186170 EST: SGN-E373017 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293974Length: 600 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293974 [] (trimmed) GTCAACATGATCCAGGAGTCGCTGAAGTTAGCCTATGGAGAGAACTCAGACTTGATAAAAGATAAACGCATTGCTGCAATTCAAGCATTATCTGG
AACAGGCGCATGCAGAATTTTTGCGGACTTCCAAAAGCGCTTTTGTCCTGATTCACAGATTTATATTCCTGTTCCTACATGGTCTAATCATCATA
ACATTTGGAGAGATGCTCACGTCCCTGAGAAAACATATCACTATTATCATGCTGAATCAAAGGGCTTGGACTTTGCTGCAATGATGGATGATATA
AAGAATGCCCCAAAAGGATCATTCTTTCTGCTTCATGCTTGTGCTCATAATCCTACTGGGGTGGATCCGACAGAGGAACAATGGAGGGAGATCTC
GCACCAGTTCAAGGTGAAGGGACATTTTGCTTTGTTTGACATGGCATATCANGGATTTGCAAGTGGGTATCCAGAGAAGGATGCTAAAGCAATCA
GGATATTTCTTGAGGATGGTCATCCNATAGCATGTGCCCAATCATATGCAAAAAATATGGGGCTATATGGTCAGAGAGTTGGTTGCCTAAGTGTT
GTCTGTGAGGATGAAAAACAAGCAGTGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293974] SGN-U577882 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105817 [Download] [View] Facility Assigned ID: TMEBY51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5