EST details — SGN-C81369

Search information 
Request: 81369Match: SGN-C81369
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C81369Clone name: cLET-15-P8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184743 is on microarray TOM1: SGN-S1-1-4.2.14.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184743 [TUS-45-J5] Trace: SGN-T198707 EST: SGN-E397381 Direction: 3' Facility: INRA
Clone: SGN-C184743 [TUS-45-J5] Trace: SGN-T198708 EST: SGN-E397382 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293639Length: 525 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293639 [] (trimmed) GCAAATGATAACTACACTTATGTAGATGACAATTCCTTGTTGGCATCATCAAAGGCTGTCAACCAGCGTGATGCAGATCTTTTACATTTCTGGGA
CAAGTTCCGCAAGGCTCCTGAAGGCTCTGCTCGGAAAGTTGAAGCTCAGAAACAATTCACTGAAGCTATGTCACACAGAATGCACCTAGATGAAC
GCATTGCCCTTGTTGGTAAGCTTCTGTTTGGAATTCAAAAAGGTCCTGAGGTGCTGAAGCATGTTCGATCTGCGGGTCAGCCTCTTGTTGATGAT
TGCGCCTGCCTTAAATCTTTTGTAAGAACATTTGAGTCGCACTGCGGATCGTTATCCCAATATGGAATGAAACACATGCGTTCCATTGCCAATAT
CTGCAATGCTGGAATTCAGATGGAGCAGATGGTGGAGGCATCAGCACAAGCTTGTCCTAGCATCCCTTCCAATATTTGGAGTTCCCTCCACAGGG
GCTTTAGTGCGTAAAACGCCATGGACTGTGCGGTTTCTCACTTTGATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293639] SGN-U579062 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106590 [Download] [View] Facility Assigned ID: TMECH88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5