Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C82294

Search information 
Request: 82294Match: SGN-C82294
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82294Clone name: cLET-1-I12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179472 is on microarray TOM1: SGN-S1-1-3.2.2.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179472 [TUS-31-N14] Trace: SGN-T185686 EST: SGN-E373548 Direction: 3' Facility: INRA
Clone: SGN-C179472 [TUS-31-N14] Trace: SGN-T185687 EST: SGN-E373549 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292165Length: 532 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292165 [] (trimmed) TAACCTCAAAGGAGCAGCAGCCATGGCGAGAATAAAGGTTCATGAGTTGAGGAACAAGTCGAAGACAGACCTTTTGGCTCAGTTGAAGGATCTGA
AGGCGGAGCTTGCTCTTCTCCGTGTTGCAAAGGTCACCGGTGGTGCTCCTAACAAGCTATCCAAAATCAAGGTGGTAAGGTTGTCAATTGCACAG
GTTTTGACTGTCATCTCACAGAACCAAAAGTCAGCTCTTAGGGAAGTTTACAAGACCAAGAAGTCCTTGCCTCTTGATCTTCGCCCCAAGAAAAC
CAGAGCAATCCGTAAACGTTTGACTAAGCACCAGTCATCCTTGAAGACAGAGAGAGAGAAGAAGAAGGAAATGTACTTCCCCATTAGGAAATATG
CTATCAAAGTGTAGGGATAGGATCTACTTTGGCTGAGATTTTTGCTTTGGATCAAAATTATTTGTTGAACTTATCAGCAATACAAGTTTTGTTTT
GCTTTGTTTCGTCGATGACATTTGATACATGATCAATGTGTTGGGAAAAAAAATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292165] SGN-U577927 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102439 [Download] [View] Facility Assigned ID: TMEAB54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0077 Quality Trim Threshold: 12.5