EST details — SGN-C82345

Search information 
Request: 82345Match: SGN-C82345
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82345Clone name: cLET-1-K20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184525 is on microarray TOM1: SGN-S1-1-6.1.14.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184525 [TUS-45-A3] Trace: SGN-T198449 EST: SGN-E397123 Direction: 5' Facility: INRA
Clone: SGN-C184525 [TUS-45-A3] Trace: SGN-T198539 EST: SGN-E397213 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292360Length: 366 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292360 [] (trimmed) ATCAAGNTCCTGAAAGGAACTGCATTCTGGATGGCCCCAGAGGTTGTTAATAGGAAGAGCAATGGATATGGTACTCCTGCTGATATATGGAGTTT
GGGTTGCACTGTCTTAGAGATGTTAACTGGACAAATTCCTTATTCTCACTTGGAAGGGATGCAAGCACTGTTCAGGATAGGCAGAGGTGAACCTC
CTCCTATACCAGATACCTTATCGACAGAAGCTCAGGATTTCATAAAAAGCTGTTTGCGAGTTAATCCAAATGATCGACCAACTGCAGCTGAGCTA
CTAGAACATCCATTCGTTATGAAGCCGCTGTCAAATTTCTCAAGTCCTTTAGCGCCATAAATTCTGCTGTCAATTGTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292360] SGN-U581710 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102634 [Download] [View] Facility Assigned ID: TMEAB70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5