Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C82433

Search information 
Request: 82433Match: SGN-C82433
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82433Clone name: cLET-1-O19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179578 is on microarray TOM1: SGN-S1-1-1.2.1.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82433 [cLET-1-O19] Trace: SGN-T102598 EST: SGN-E292324 Direction: 3' Facility: TIGR
Clone: SGN-C179578 [TUS-32-B24] Trace: SGN-T186289 EST: SGN-E372808 Direction: 3' Facility: INRA
Clone: SGN-C179578 [TUS-32-B24] Trace: SGN-T186290 EST: SGN-E372809 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292147Length: 659 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292147 [] (trimmed) AAAACCCTACAGCTCCCTCTTACGAAGCTTAGCTTCGAGTTTTTCTTCTCATCTTTTCGATAATGGCTTTACCAAACCAGCAAACTGTAGACTAT
CCAAGCTTCAAGCTTGTTATTGTGGGAGATGGAGGAACTGGCAAGACAACATTTGTCAAAAGGCATCTCACTGGTGAATTCGAGAAAAAATACGA
ACCCACTATTGGTGTGGAGGTTCATCCACTAGACTTCTTCACAAATTGTGGGAAGATTCGGTTTTATTGCTGGGATACAGCTGGACAAGAGAAGT
TTGGAGGTCTCAGAGATGGTTACTACATTCATGGGCAATGTGCAATTATCATGTTTGATGTTACAGCCCGTCTGACCTACAAGAATGTTCCTACA
TGGCATAGAGATCTTTGTAGGGTTTGTGAAAACATCCCCATTGTTCTCTGTGGAAACAAAGTTGATGTCAAGAACAGGCAGGTTAAGGCTAAGCA
AGTTACCTTCCACAGGAAGAAAAATTTGCAATACTATGAGATCTCAGCAAAGAGTAACTACAACTTTGAGAAGCCTTTTCTGTACCTTGCCAGAA
AGCTTGCTGGGGATGGTAATCTTCACTTTGTGGAGTCACCTGCACTTGCTCCCCCAGAAGTACACATCGACTTANCTGCACAGGCACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292147] SGN-U580136 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102421 [Download] [View] Facility Assigned ID: TMEAA94THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5