EST details — SGN-C82595

Search information 
Request: 82595Match: SGN-C82595
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82595Clone name: cLET-20-J12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181914 is on microarray TOM1: SGN-S1-1-1.4.10.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181914 [TUS-38-D8] Trace: SGN-T187759 EST: SGN-E374489 Direction: 3' Facility: INRA
Clone: SGN-C181914 [TUS-38-D8] Trace: SGN-T187760 EST: SGN-E374490 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295208Length: 582 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295208 [] (trimmed) GACAAAGTCGGAGTAGTTGGCATGACTGGAGCTGGAAAATCTAGCATGTTTAATGCTTTGTTCCGACTTGTTGAGCTTGAAAGAGGAAGGATATT
AATAGATGATTATGATGTTTCAAAGTTTGGACTTACAGATCTACGGACGGTTCTTGGTATTATACCGCAAGCACCAGTTTTGTTCTCAGGGACCG
CGAGATTTAATCTTGATCCATTCAATGAGCACAATGATGCTGACCTCTGGGAGTCTCTAGAACGTGCGCACCTAAAGGACGTTATCAGGAGGAAC
TCTTTGGGTCTTGATGCGGAGGTCTCGGAAGCCGGAGAAAATTTCAGTGTTGGACAAAGACAGCTTTTAAGTCTTGCTAGAGCATTGCTTCGCCG
GTCAAAGATTCTTGTTCTTGATGAAGCAACTGCTGCTGTTGATGTTAGAACTGATGCTCTTATTCAGAAAACCATACGCGAAGAATTTAAGTCAT
GCACCATGCTCATTATTGCTCACCGTTTGAACACTATCATAGACTGTGACAGAATTCTTCTGCTTGATTCTGGTCAGGTACTTGAATATGATACT
CCGGAAGTATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295208] SGN-U569979 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107622 [Download] [View] Facility Assigned ID: TMEDB54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5