Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C83114

Search information 
Request: 83114Match: SGN-C83114
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C83114Clone name: cLET-23-F8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181972 is on microarray TOM1: SGN-S1-1-7.2.10.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181972 [TUS-38-F18] Trace: SGN-T187773 EST: SGN-E374503 Direction: 3' Facility: INRA
Clone: SGN-C181972 [TUS-38-F18] Trace: SGN-T187774 EST: SGN-E374504 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295433Length: 527 bp (831 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295433 [] (trimmed) TCAGATTAAGCTTGTTGAAGGTGACTCTGCTGGAACTGTCACTGCATTCTATATGTCATCAGATGGACCAACCCACAATGAGTTTGATTTTGAAT
TTTTAGGCAATACAACTGGTGAACCATATACAGTACAAACAAATGTGTATGTCAATGGTGTTGGTAACAGAGAACAGAGATTGAAGCTTTGGTTC
GACCCATCGAAGGATTTTCACTCTTATTCCATCATGTGGAATCAACGTCAAGTTGTATTCTTGGTAGATGAAACCCCTGTTCGAGTGCATTCGAA
TTTGGAGCATAGAGGAATCCCATACCCCAAGGATCAACCAATGGGTGTGTATAGTTCGATTTGGAATGCAGATGATTGGGCTACACAAGGCGGGC
TCGTTAAGACTGATTGGTCACACGCGCCCTTCGTAGCATCCTATAAGGGATTTGAGATTAACGGTTGTGAGTGCCCGGCAACTGTTGCAGCTGCT
GAGAATACTCGGCGTTGCAGCAGTAATGGGCAGAAGAAGTACTGGTGGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295433] SGN-U580834 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108158 [Download] [View] Facility Assigned ID: TMEDN28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5