Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C83249

Search information 
Request: 83249Match: SGN-C83249
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C83249Clone name: cLET-23-O14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184634 is on microarray TOM1: SGN-S1-1-1.1.14.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184634 [TUS-45-E16] Trace: SGN-T196546 EST: SGN-E395220 Direction: 3' Facility: INRA
Clone: SGN-C184634 [TUS-45-E16] Trace: SGN-T196547 EST: SGN-E395221 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295383Length: 472 bp (970 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295383 [] (trimmed) TTCACAAGGAAGTTAATTTTGTCGCTTACCTACTAATTGTTCTTGGAATGTTTCTATATGTTGATGCCAAGGCTTGTACTAGAGAATGTGGTAAT
CTTGGGTTCGGGATATGCCCACGTTCAGAAGGAAGTCCGCTAAATCCCATATGCATCAATTGTTGCTCAGGCTATAAGGGTTGTAATTATTATAA
TTCTTTCGGAAAATTTATTTGTGAAGGAGAATCTGATCCAAAAAGGCCAAATGCTTGCACCTTTAATTGTGATCCAAATATTGCCTATTCAAGAT
GTCCCCGTTCACAAGGAAAATCGTTAATTTATCCCACCGGATGTACCACATGTTGCACAGGGTACAAGGGTTGCTATTATTTTGGTAAAGATGGA
AAGTTTGTATGTGAAGGAGAGAGTGATGAACCCAAGGCAAATATGTACCCTGTAATGTGACTCTAGACTTGTCCATCTTCTGGATTGCCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295383] SGN-U578366 Tomato 200607 Build 2 209 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108108 [Download] [View] Facility Assigned ID: TMEDL91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0088 Quality Trim Threshold: 12.5