EST details — SGN-C83399

Search information 
Request: 83399Match: SGN-C83399
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C83399Clone name: cLET-24-I22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184672 is on microarray TOM1: SGN-S1-1-3.3.14.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296105Length: 345 bp (955 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E296105 [] (trimmed) TCATTTCAAGATTTTGAATTGCTCTAATTTTTTTTTCCTCTGAAATTTGCTCTGTTCAACTCATAGTAATCGCGTTGGTGTATCGATAATGAATC
GGACCAAAATCAAGCGTAGAGTTGGTAAATATGAAGTTGGAAGGACAATTGGTGAGGGAACGTTTGCGAAAGTCAAGTTTGCAAAGAATTCAGAG
ACGGGAGAAAGTGTGGCGATCAAAATCCTCGATAAAGATAACGTCCTTAAGCACAAAATGGCTGCCCAGATAAAGCGGGAAATAGCTGCAGTGAA
GTTGATCAGACATCCTCATGTTGTACAGTTATACGAGGGTATGGGAAGCGTGACGAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296105] SGN-U577671 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108622 [Download] [View] Facility Assigned ID: TMEDP59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0289 Quality Trim Threshold: 14.5