Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C84435

Search information 
Request: 84435Match: SGN-C84435
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C84435Clone name: cLET-28-M23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182112 is on microarray TOM1: SGN-S1-1-3.4.10.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182112 [TUS-38-L14] Trace: SGN-T1703 EST: SGN-E378208 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182112 [TUS-38-L14] Trace: SGN-T187732 EST: SGN-E374462 Direction: 3' Facility: INRA
Clone: SGN-C182112 [TUS-38-L14] Trace: SGN-T187733 EST: SGN-E374463 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297699Length: 451 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E297699 [] (trimmed) CTTCCTTTGAGACTCTCATGGCACGAAAAGAAATTGGTGGACCAGAAGTCATCGAACTTCTAAAGGAATATGAATCTAACTTGATGTGCAAAGGA
AAACGAATGTGGCCAGAACTTATTGGTGTACCAGCACAATATGCTAAGGGAATAATTGAAAAGGAAAATCCATTCATAACTGATGTTCGGATAGG
ATTGATTGGTTCTCCACGCACAGCTGATTTTAAGTGTTTTCGAGTTCGTATTGCTGTAAACATCTTGGATGTTGCTGTATCAATGCCTGTGATTG
GTTAATTAATGAAGTAATTAAGTAGCCACATGTCAAAAAATAATTAGGGTTCATGTCTGTTCATTAATTATAATGTACCCATGCATGTACTCTTA
CAATACATAATGGAATAAATAAGTGTGACTTGATTAAATATTAAATGTAATCTCCCTAATTAAATCTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297699] SGN-U581582 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109493 [Download] [View] Facility Assigned ID: TMEEE84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5