EST details — SGN-C85865

Search information 
Request: 85865Match: SGN-C85865
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C85865Clone name: cLET-41-D8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184791 is on microarray TOM1: SGN-S1-1-4.4.14.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184791 [TUS-45-L5] Trace: SGN-T198725 EST: SGN-E397399 Direction: 3' Facility: INRA
Clone: SGN-C184791 [TUS-45-L5] Trace: SGN-T198726 EST: SGN-E397400 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298388Length: 548 bp (990 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298388 [] (trimmed) TCCATCTCCTCTGCATCACCTACAAGAACAAATTCAATCATTACCCAGTTTTCTTCATCATTCAAGGGTAATGTAAGTAATTTGAAGTCAAGTTC
GAAGCTTTTGCCTTTAATAAAGGTCTGCAATTTGAAATCTAAGTCAATAACAAGAACCCCATTTGTTGTTTTCAACCAAACTGCAAGTTTTGGTG
CTGATTCTGCAACTGGGAGTGTTCGTTTTCGGCTTAATAACTTGGGTCCTCAACCTGGGGCTACCAAGAATAGGAAGAGGAAAGGTAGAGGGCAT
TCAGCTGGACAAGGGGGTAGTTGTGGTTTTGGTATGAGAGGTCAAAAATCAAGGTCTGGACCTGGAGTTAGAAAGGGGTTTGAAGGGGGTCAAAT
GCCTCTCTATAGGAGACTTCCTAAGTTGAGAGGAATTGCTGGAGGCATGCATGCTGGACTTCCCAAATATGTACCTGTGAACTTGAAGGACATAG
AAGAGGCAGGATTTCAAGAAGGGGAAGAGGTTTCACTTGAGTCCCTCAAGCAAAAGGGTTTAATAAATCCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298388] SGN-U572020 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110425 [Download] [View] Facility Assigned ID: TMEGH16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5