EST details — SGN-C86546

Search information 
Request: 86546Match: SGN-C86546
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C86546Clone name: cLET-43-H3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181646 is on microarray TOM1: SGN-S1-1-5.1.12.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299437Length: 430 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E299437 [] (trimmed) AATTGGCTAAAGTCAAATGGATCCAATATGGTTGGAGTTACTGGATACTGCATGGGTGGTGCTCTTGCGATTGCAAGTTCTGTTTTGGTCCCAGA
GGTTAATGCAGTCGTAGCCTTTTATGGGGTTCCTTCACCAGAGCTTGCTGATCCTGTTAATGCTAAGGCCCCTGTGCAAGCTCATTTCGGTGAAG
ATGATGCTTTTGTTGGGTTTTCAGATGTAAAGACTGGTAAAGCTCTATAGGAAAAACTGAAAACAGCAGGAGTTCCACATGAGGTTTACTTCTAT
CCAAAGACTGGACACGCATTCATGAACAAGTCACCGGAGGGCGTTGAAAGGAGGCAAAAGATGGGGATGCCTGATGTACAAGATGCTGCCGTAGA
TCAAGCTTGGTCCCGCTTCCGTTCATGGATGAGTCGATTCTTATCTGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299437] SGN-U578584 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111178 [Download] [View] Facility Assigned ID: TMEGO38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0243 Quality Trim Threshold: 12.5