EST details — SGN-C87306

Search information 
Request: 87306Match: SGN-C87306
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C87306Clone name: cLET-45-O5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C185094 is on microarray TOM1: SGN-S1-1-5.4.11.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185094 [TUS-46-H20] Trace: SGN-T192014 EST: SGN-E390688 Direction: 5' Facility: INRA
Clone: SGN-C185094 [TUS-46-H20] Trace: SGN-T192264 EST: SGN-E390938 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300408Length: 546 bp (964 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300408 [] (trimmed) CAGCTGCTGAGGACATTACTGAAGAAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACC
GCTTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAAT
TAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGG
TTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGG
AAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCATGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCGTATCAT
CGGATTCGACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300408] SGN-U579638 Tomato 200607 Build 2 317 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111580 [Download] [View] Facility Assigned ID: TMEGU87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0113 Quality Trim Threshold: 12.5