Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C91691

Search information 
Request: 91691Match: SGN-C91691
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C91691Clone name: cLEW-8-C9
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: Alias clone SGN-C185124 is on microarray TOM1: SGN-S1-1-7.2.12.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185124 [TUS-46-J2] Trace: SGN-T192017 EST: SGN-E390691 Direction: 5' Facility: INRA
Clone: SGN-C185124 [TUS-46-J2] Trace: SGN-T192266 EST: SGN-E390940 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300691Length: 473 bp (988 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300691 [] (trimmed) CACTCATACCTTCGTATACTTTTATATATAAATTATTTAGCATAGTGAGTGGGAGGGAGAACGGACGGGAGACATCGTCGGAGGTGGGAATCGTT
TGTATCAGCTTCTTTTATCGTCATCGGAAAGACTATGTCAGAGGTAATTGGATACTGAAGCTTGAGATGGCTGCTACTGCAACTGCATCTTCTAC
TGGTCCACGTTATGCACCAGAGGATCCCACCCTTCCCAAACCTTGGAAAGGCCTAGTTGATGGTAAGACTGGATATCTCTATTTCTGGAATCCAG
AGACCAATACTACCCAATACGAGAAGCCTGACGCTACTCCTCATGTGGGTGCTGCACAACATAAATCCTCTGCATCTGTAAGTTCATCAGTTGAG
AGGCCTTCTCAAAGTCAATGTTCTGACCATGGTGACAACAGAGGTACCAATGGTGCCTAGAGCAAACTTTCCTCTGGAGAGGGTCTTCAGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300691] SGN-U562803 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112296 [Download] [View] Facility Assigned ID: TRDBC17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0306 Quality Trim Threshold: 14.5