Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C93328

Search information 
Request: 93328Match: SGN-C93328
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C93328Clone name: cLEX-14-G12
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C185194 is on microarray TOM1: SGN-S1-1-1.4.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185194 [TUS-46-L24] Trace: SGN-T192031 EST: SGN-E390705 Direction: 5' Facility: INRA
Clone: SGN-C185194 [TUS-46-L24] Trace: SGN-T192276 EST: SGN-E390950 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305590Length: 702 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305590 [] (trimmed) GGAGAAGCTTCTCATGAATGGAGACGAATTTCAGAAACAGGAGATGATTCAGAGATTGAAACCCTAGTTTCTTCATCAATGTTCCAATCGTTAAT
TTCTGTTTGATTTTAATCTTCGGCGTGCAAAAACTCCGATTCTGTTGGTCAATTTCATAGCAATTGGATTTTACCTCGATTCGATCTGAGGACTT
TTGGGTCTTTTTTTGCTAATCGAAGCGGTGAGGAATATTTAGGCAGGTGATTGTAGAGGATAATTTTGTTTGAAAAAATGCCGTCGCACGCGGAT
GTAGATCGGCAGATCGAGCAATTGATGGAGTGCAAGCCGTTATCGGAGGCGGAGGTGAAGACGTTGTGTGAACAAGCAAGGGCGATACTAGTGGA
GGAATGGAATGTGCAACCGGTGAAATGTCCGGTGACGGTGTGCGGTGATATCCATGGACAGTTTTACGATCTGATTGAGCTTTTTCGAATCGGCG
GCAACGCTCCTGATACTAATTATCTCTTCATGGGAGATTATGTTGACCGTGGATACTATTCTGTCGAGACTGTCTCACTATTGGTTGCTTTGAAG
GTTCGTTATACAGATAGAATCACAATTCTTAGGGGAAACCATGAAAGCCGACAGATCACTCAAGTGTATGGTTTTTATGATGAATGTTTGAAGAA
GTATGGAAATGCCAATGTTTTGAAATATTTCACTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305590] SGN-U567351 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118076 [Download] [View] Facility Assigned ID: TRXCB42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5