EST details — SGN-C93561

Search information 
Request: 93561Match: SGN-C93561
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C93561Clone name: cLEX-15-A4
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C183290 is on microarray TOM1: SGN-S1-1-1.1.3.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183290 [TUS-41-M16] Trace: SGN-T196522 EST: SGN-E395196 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305239Length: 455 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E305239 [] (trimmed) GGCTGCCGGACTATAAGTACGGAGGCTTGTTTGATCAAAAATGGGGGGAAGTTGCTTTCTGGTTTTGCTTCTTCAAATCATAGTTACTCAAGTTG
TTGGTGTTGGTGTTGGTGTTGGCGTTGGCGTTGGTGTTGGTGTTGGACCTGGAGGTGTTTGGTTTGGTGGAGGGATCAACAGCCCAAACCCAGGA
GCTGTCCCAAGTCAAAGTTCAGCATACACTGCTCTTCAAGCATGGAAATCTGCAATTACTGATGATCCATCGGGGATTTTGAAGAATTGGGTGGG
TCCAAATGTGTGTAGTTACAAAGGAATTTTCTGCTCAAACTCTCAAGATTACATGGGCAACCCAACAGACCCAGTTGTTACAGGTATAGATCTCA
ATCATGCAAATCTTCAAGGCACTCTAGTAAAAGAACTATCTTATTTAACAGATGTGTCTCTCATTCATCTCAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305239] SGN-U572169 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117725 [Download] [View] Facility Assigned ID: TRXCF02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5