EST details — SGN-C93855

Search information 
Request: 93855Match: SGN-C93855
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C93855Clone name: cLEX-15-P18
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C186093 is on microarray TOM1: SGN-S1-1-6.2.5.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305366Length: 595 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E305366 [] (trimmed) GGGAGCTTTGGAGTGTGCCGTGTGTCTGAACGAATTTGAAGATGATGAAATGTTGCGTTTGATCCCTAAGTGTGATCACGTTTTTCATCCTGAAT
GCATCGATGCTTGGCTCAAATCTCATGTAACTTGCCCTGTTTGCCGAGCTGATCTTACTCCTAAACCTGATGAACCGGTGCCGGTTCAAACTCCT
GAGGTGAACCGGGAATTGGGGCAAGAACAGGAGAATACACAGCAAAATAACGAAGTTACGATTCAAATAGATGTAGATGAGAATTTGATGTCACA
GCAAGAGGAGACCTCTGTAAAACCAGAAGTTAAACGAAATTTGAGTTTCAACGCGGTGAACCGGCCGCCGAGGTCTTTTTCTCTGAAGAGACCAA
AGATGTTAAGCAAATTCAGGTCACATTCGACCGGTCACTCATTAGTGGTACCAGGGGAGAATTTAGACCGGTATACTCTTAGATTGCCGGAGAAG
GTGAGGAAAGATGTAATGGACCGGGCTCTACTAAACCGGACAAGGAGCTGTGCAGTCACGCTACCAAGACACGGTAGCACCACAAGAGGATACAG
AGCCGGTCCAGGAGAGGGAAGCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305366] SGN-U568090 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117852 [Download] [View] Facility Assigned ID: TRXCH93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5