EST details — SGN-C94767

Search information 
Request: 94767Match: SGN-C94767
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C94767Clone name: cLEX-5-I11
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C181497 is on microarray TOM1: SGN-S1-1-2.2.12.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181497 [TUS-37-B23] Trace: SGN-T194233 EST: SGN-E392907 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303220Length: 530 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303220 [] (trimmed) GCCAACACATTGCTCATTACAAAGCTGGAATTGTCCCTGTTGCTTATAGAAGGGTACCCTGTAGAAGAAGGGGAGGAATAAGGTTCACAATCAAT
GGACACTCATACTTCAACTTAGTACTAGTAACAAATGTTGGTGGTGGTGGTGATGTTCATTCAGTAGCTGTTAAAGGATCAAGAACAGGTTGGCA
GCCAATGTCAAGAAACTGGGGACAAAACTGGCAAAACAACAACAACCTTAATGGACAAACACTATCATTTAAGGTTACAACAGGTGATGGTAGAA
GTTTGATCTCATACAATGTTGCACCTGCTCACTGGTCATTTGGACAGACATATACTGGTGCTCAATTCCACTAAAAAAAGGCATTAAATGGGGCT
TTTTTTTTCTTCAAGTTTTTGAAAGTATATTTACTAGAATTACTATTATCATTACTAGTATTAGTATGCATACTGATTTGGTCACTAGTATTAGT
ATTGTGACTATTTAGTATACAGGTATTTTGGTTGTAAAGGTGTGGTCTTTAAGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303220] SGN-U585093 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116417 [Download] [View] Facility Assigned ID: TRXAQ54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5