Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C95034

Search information 
Request: 95034Match: SGN-C95034
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C95034Clone name: cLEX-6-N22
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C185144 is on microarray TOM1: SGN-S1-1-3.2.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185144 [TUS-46-J22] Trace: SGN-T197616 EST: SGN-E396290 Direction: 5' Facility: INRA
Clone: SGN-C185144 [TUS-46-J22] Trace: SGN-T197656 EST: SGN-E396330 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304264Length: 474 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304264 [] (trimmed) GCTTTCAATCGTTTCTATTGACGTAGTTCAACAGATCGAAAGATGTTTGGAAGAGCACCGAAGAAGAGCGATAATACAAAGTATTATGAGATCTT
AGGAGTTCCTAAGGCTGCTTCTCAGGAAGATCTCAAAAAGGCTTATCGTAAAGCTGCTATCAAAAATCACCCTGATAAGGGAGGCGATCCTGAGA
AGTTTAAAGAGCTTGCTCAAGCTTATGAGGTCTTGAGTGACCCGGAGAAGCGTGAGATATATGATCAGTATGGAGAGGATGCTCTAAAGGAAGGA
ATGGGTGGTGGAGGTGGTGGACATGACCCATTTGATATATTTCAATCATTCTTCGGTGGTGGAGGAAACCCCTTTGGTGGTGGTGGAAGCAGCAC
AGCTCGTAGACAAAGAAGAGGAGAGGATGTTATGCACCCGCTCAAGGTTTCTTTAGAGGATCTTTACAATGGGACATCAAAGAAGCTTTCACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304264] SGN-U578974 Tomato 200607 Build 2 199 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116282 [Download] [View] Facility Assigned ID: TRXAX83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0160 Quality Trim Threshold: 14.5