EST details — SGN-C95395

Search information 
Request: 95395Match: SGN-C95395
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C95395Clone name: cLEY-11-L23
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: Alias clone SGN-C186099 is on microarray TOM1: SGN-S1-1-8.2.5.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306988Length: 478 bp (987 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306988 [] (trimmed) GGTGCTATAAGCCTGAAGATGCTAGGATATGCACAAGGAAGATTTTCATGGAGAGGTCAAAGTTGGTTGGTTCATTCCCTGATGAAACTCTTGAG
TTCCAGAGGAAAATTCTTGAGAGGTCTGGCCTTGGTGAATCAACTTATCTCCCTGAAGCTGTGCTGAGGGTACCACCAAATCCTTGTATGGCAGA
AGCACGGAAAGAAGCTGAGATGGTTATGTTTGGTGCCATTGATGAGCTCCTTGCTAAAACTGGTATTAAGCCAAAAGATATCGGAATTCTAGTAG
TAAATTGCAGCTTGTTTAATCCAACACCCTCTTTGTCTGCAATGATTGTGAACCATTACAAGCTCCGTGGAAACATTGTGAGCTACAATCTANGT
GGAATGGGTTGCAGTGCTGGTTTGATCTCGATCGATCTTGCAAAAGATCTTCTTCAAGTACATCCCAATACCTATGCTTTGGTGCTCAACATGGA
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306988] SGN-U579167 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118912 [Download] [View] Facility Assigned ID: TRYBQ72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5