EST details — SGN-C95505

Search information 
Request: 95505Match: SGN-C95505
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C95505Clone name: cLEY-12-D11
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: Alias clone SGN-C182569 is on microarray TOM1: SGN-S1-1-2.3.8.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182569 [TUS-39-O15] Trace: SGN-T194748 EST: SGN-E393422 Direction: 5' Facility: INRA
Clone: SGN-C182569 [TUS-39-O15] Trace: SGN-T199374 EST: SGN-E398048 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307430Length: 563 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307430 [] (trimmed) GGTCACATGTTGTCCTTACTGTAAACAGGTGCTCACAGTCTGTGCTGTTAATTCAGCAAAAGTATGGGATATATCTGAAGATGGAAAAGGGAAAG
TAGAACAAAACACTGGCTTCTTCTGGTTCTGGTGGAGTTGATGACATGCTACTTGGCTGTCTCTGGCAAAATGACCATCTTGTTACTGTGGTCTC
TCGGTGGAACTATTTCCATATTCTCAGCAAGTGATCTGGAAAAACCTCCCGCGTCATTTTCTGGGCACATGAAAAATGTTAATTCCTTATCTGTC
CTCAGAAGTGACCCGAAAATCATATTGTCCACCAGTTATGATGGTTTGATTGTTAAATGGATTCAAGGCATTGGATATAGCGGGAAATTAGACCG
AAAGGTGACTTCTCAAATCAAATGCTTTGCAGTTGTGGAAGGAGAACTTGTGTCATGTGCGTTCGACAACAAGATCTGGAGAGTATCTCTGCTTG
GAGATCAATGTGGAGATGCAAATTCTATAGATGTTGGCACCCAACCTAAAGACTTAAGCCTTGCCCTTAATTCTCCTGAAGTGACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307430] SGN-U568055 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119139 [Download] [View] Facility Assigned ID: TRYBU18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0226 Quality Trim Threshold: 14.5