Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C97986

Search information 
Request: 97986Match: SGN-C97986
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C97986Clone name: cLEY-25-D18
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: Alias clone SGN-C186139 is on microarray TOM1: SGN-S1-1-8.4.5.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308375Length: 442 bp (831 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308375 [] (trimmed) GTGGCAGCCCTGCAATTCCTAACAGGATCACAGAATGCAGATCATATCCATTGTACAGGTTGGTGAGACAAGAACTTGGATCAGAACTTTTGACA
GGTGAAAAAGTTCGATCACCCGGTGAGGAGATCGACAAGGTGTTCACATCAATGTGCAATGGACAGATCATTGATCCATTGTTGGAGTGTCTCAA
GAGCTGGAATGGTGCTCCTCTTCCAATCTGCTAGATGCTTGCCAGAAAAAAAGACCAGTTGTGAATGCTTGTCTAGTGCTATTTTTCAAACTCTT
TTTTTGCTTTATGGCGAATTACTATCATAATATGTTGTGAACTCACATCTTTGTTGGTTAACTTGAGAGAGTGTTACACTATCTCAAATATGAAT
ATGTCTCTTTTCAGCGAAAAACTGCAATGAAAAGTGACAGTGTGCTTATGTCTATGGCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308375] SGN-U577677 Tomato 200607 Build 2 202 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121638 [Download] [View] Facility Assigned ID: TRYDV21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0266 Quality Trim Threshold: 12.5