ESTScan Details for Unigene SGN-U198687

Score 
247
Direction 
Forward
Predicted Peptide Sequence 
MVESNGNLENHVQIPKIKFTKLFINGEFVDSVSGNTFETIDPRNGEIIARISEGDKEDINLAVKAAREAFDNGPWPRLPPSGEEKDNX
Predicted Coding Sequence 
ATGGTGGAATCAAATGGAAATTTAGAAAATCATGTCCAAATCCCAAAAATTAAGTTCACCAAGCTCTTTATCAATGGAGAATTCGTCGAT
TCCGTTTCAGGAAATACGTTCGAGACGATAGATCCAAGAAATGGGGAGATAATTGCAAGAATTAGTGAAGGTGACAAAGAGGATATTAAT
TTGGCTGTCAAAGCTGCTCGTGAAGCTTTCGATAATGGCCCTTGGCCTCGTCTACCCCCTTCXGGAGAGGAGAAGGATAATGXX\
Edits in Original Sequence 
AAACAACAACACTAGCAGAAAATAGTCAAATTTAATTTGCCATTTTCCCTGTGTGAAGCTTTTTAAAGAAAAAAAAAAA(5')ATGGTGG
AATCAAATGGAAATTTAGAAAATCATGTCCAAATCCCAAAAATTAAGTTCACCAAGCTCTTTATCAATGGAGAATTCGTCGATTCCGTTT
CAGGAAATACGTTCGAGACGATAGATCCAAGAAATGGGGAGATAATTGCAAGAATTAGTGAAGGTGACAAAGAGGATATTAATTTGGCTG
TCAAAGCTGCTCGTGAAGCTTTCGATAATGGCCCTTGGCCTCGTCTACCCCCTTCXGGAGAGGAGAAGGATAATGXX\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan