ESTScan Details for Unigene SGN-U199565

Score 
130
Direction 
Forward
Predicted Peptide Sequence 
AAKGXPLNAERRDYFIKAIRRSFSSTPSPISQMDQSTRYRYGPALKWNPMVEEYFVKAYGADRFARISTALTAHHVTLVYXVNTLKSTSD
TVIEKLLEIFKERGMAMSQFKNALEVXNLLRQSNASRSVNXPGLDYVVFIKGSXPHAIHYGDNEGKPL
Predicted Coding Sequence 
XCGGCCGCTAAGGGAXTTCCTCTGAATGCAGAAAGGAGGGACTACTTCATCAAAGCCATTCGTCGAAGCTTCAGCAGCACTCCCAGTCCC
ATTTCTCAGATGGATCAATCAACGCGTTATCGTTATGGTCCAGCTTTGAAATGGAACCCTATGGTTGAAGAATACTTCGTCAAAGCATAT
GGAGCTGATCGTTTTGCTCGTATTTCTACTGCACTCACTGCCCATCATGTTACTCTTGTATACGXGGTGAATACGCTCAAATCAACAAGT
GATACTGTTATCGAGAAGCTTTTGGAAATTTTCAAGGAAAGAGGAATGGCAATGTCGCAGTTCAAGAATGCATTGGAAGTGCANAATCTC
TTAAGGCAATCAAATGCATCTCGAAGTGTCAATXATCCTGGCTTGGATTATGTAGTTTTTATTAAAGGCTCANGACCGCATGCTATTCAT
TATGGGGACAACGAAGGCAAACCTCTC\
Edits in Original Sequence 
(5')XCGGCCGCTAAGGGAXTTCCTCTGAATGCAGAAAgGGAGGGACTACTTCATCAAAGCCATTCGTCGAAGCTTCAGCAGCACTCCCA
GTCCCATTTCTCAGATGGATCAATCAACGCGTTATCGTTATGGTCCAGCTTTGAAATGGAACCCTATGGTTGAAGAATACTTCGTCAAAG
CATATGGAGCTGATCGTTTTGCTCGTATTTCTACTGCACTCACgTGCCCATCATGTTACTCTTGTATACGXGGTGAATACGCTCAAATCA
ACAAGTGATACTGTTATCGAGAAGCTTTTGGAAATTTTCAAGGAAAGAGGAATGtGCAATGTCGCAGTTCAAGAATGCATTGGAAGTGCA
NAATCTCTTAAGGCAATCAAATGCATCTCGAAGTGTCAATXATCCTGGCTTGGATTATGTAGTTTTTATTAAAGGCTCANGACCGCATGC
TATTCATTATGGGGACAACGAAGGCAAACCTCTC\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan