ESTScan Details for Unigene SGN-U201112

Score 
39
Direction 
Forward
Predicted Peptide Sequence 
MGDVKCSVVPXIPIGPGGGGAARRSDRXVSADMKSIAYKPERVRX
Predicted Coding Sequence 
ATGGGAGATGTGAAATGTTCAGTAGTTCCAXCTATCCCTATTGGGCCTGGGGGTGGTGGTGCTGCAAGGCGGAGTGATCGAXATGTAAGC
GCAGATATGAAATCCATCGCTTACAAGCCTGAGCGTGTGCGCATX\
Edits in Original Sequence 
TCTTAGAAAAATCATTGATAAGTGATATATAAAAAATATATATGCGATCGATG(5')ATGGGAGATGTGAAATGTTCAGTAGTTCCAXCT
ATCCCTATTGGGCCTGGGGGTGGTGGTGCTGCAAGGCGGAGTGATCGAXATGTAAGtCGCAGATATGAAATCCATCGCTTACAAGCCTGA
GCGTGTGCGCATX\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan