ESTScan Details for Unigene SGN-U201607

Score 
126
Direction 
Forward
Predicted Peptide Sequence 
LQIWQMAENIYHDEDDIPGDDAPKCP
Predicted Coding Sequence 
XXACTACAAATTTGGCAGATGGCTGAAAACATCTACCATGATGAAGATGACATACCCGGAGATGATGCTCCCAAATGTCCCTAG\
Edits in Original Sequence 
(5')XXACTACAAATTTGGCAGATGGCTGAAAACATCTACCATGATGAAGATGACATACCCGGAGATGATGCTCCCAAATGTCCCTAG\
(3')GATACTAACATAGCCCTCAGAAGGGTATTGTAACATCAAGTATGAGTTTCTCAAAATGTTCCCCTCCACCCCTCCTTCCGCTCTGCG
TATTTTTTCCTTTTGGAACTTAGCTTCTTTCTGCTGTCTTGGTATCTATGGTTGTTACTTTAACAACTTATTTTCATCTTTTAACATTTC
ATCTATGTATTTAGGGGGGGAAAAGCTGACCCCACTCCCTTCCTCTTTAGTTCTTTTTTCTTCATTTTTTCTGGCATTGGCAAATGATTT
GGCCAGCTTTTAAAAAAAAAAAAAAAAAAAAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan