ESTScan Details for Unigene SGN-U202731

Score 
68
Direction 
Forward
Predicted Peptide Sequence 
NLRFCADIPDFLTGEGLLTNLPTPLCGSGDIFSGGRGPAFSFNYISRNFGLLLVDLVSFSSSEVASXVKLEPVEKKAATTNTIALDRRL
Predicted Coding Sequence 
XTAAATCTGAGATTTTGTGCTGACATTCCAGACTTCTTGACAGGTGAGGGTCTTCTAACCAATCTACCAACACCACTTTGCGGAAGTGGG
GATATCTTCTCAGGTGGACGGGGCCCTGCATTCTCTTTTAATTATATTTCCAGAAATTTTGGGCTTCTCCTTGTTGACCTGGTTAGCTTC
AGTAGTAGTGAAGTGGCTTCAXCAGTTAAGCTGGAACCTGTGGAGAAGAAGGCXGCTACAACTAATACTATTGCCCTAGACAGACGACTT
\
Edits in Original Sequence 
(5')XTAAATCTGAGATTTTGTGCTGACATTCCAGACTTCTTGACAGGTGAGGGTCTTCTAACCAATCTACCAACACCACTTTGCGGAAG
TGGGGATATCTTCTCAGGTGGACGGGGCCCTGCATTCTCTTTTAATTATATTTCCAGAAATTTTGGGCTTaCTCCTTGTTGACCTGGTTA
GCTTCAGTAGTAGTGAAGTGGCTTCAXCAGTTAAGCTGGAACCTGTGGAGAAGAAGGCXGCTACAACTAATACTATTGCCCTAGACAGAC
GACTT\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan