ESTScan Details for Unigene SGN-U205095

Score 
71
Direction 
Forward
Predicted Peptide Sequence 
INMMTKVKTTVINLPTPTYTMG
Predicted Coding Sequence 
XXGATTAACATGATGACTAAAGTGAAGACCACTGTGATCAATTTGCCAACCCCTACTTATACTATGGGGTAA\
Edits in Original Sequence 
(5')XXGATTAACATGATGACTAAAGTGAAGACCACTGTGATCAATTTGCCAACCCCTACTTATACTATGGGGTAA\(3')ATTAAAATC
ACTATTATATTTTGCTTTAGAAATAAGACAAATAATTGAGTGGTACTTTAATTTTAACAAGTTATGTTGTAGATGTTAGTAAACTTGAAA
AAACAAATTATTGTTTGTTTCTCCCTTTTGAGCTTATGAAGATTAATATTAGAGATAAACATTTGCTTTTTTGGATTTAAAAAAAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan