ESTScan Details for Unigene SGN-U208419

Score 
231
Direction 
Forward
Predicted Peptide Sequence 
RYDIDMTKCIYCGFCQEACPVDAIVEGPNFEFATETHEELLYDKEKLLENGDRWETEIAENLRSXKPVPLSSFVRYTLKTLAFKKFTK
Predicted Coding Sequence 
XCTAGGTATGATATTGATATGACGAAGTGCATATACTGTGGATTCTGCCAAGAAGCCTGCCCTGTTGATGCCATTGTTGAGGGACCCAAC
TTTGAATTTGCAACTGAAACCCATGAGGAACTTCTTTACGACAAGGAGAAGCTTCTTGAGAATGGAGACCGATGGGAAACTGAGATTGCA
GAGAATCTGAGATCTGAXAAGCCTGTACCGCTGAGTTCTTTCGTCAGATATACACTGAAAACTCTTGCTTTTAAGAAATTCACAAAATAA
\
Edits in Original Sequence 
(5')XCTAGGTATGATATTGATATGACGAAGTGCATATACTGTGGATTCTGCCAAGAAGCCTGCCCTGTTGATGCCATTGTTGAGGGACC
CAACTTTGAATTTGCAACTGAAACCCATGAGGAACTTCTTTACGACAAGGAGAAGCTTCTTGAGAATGGAGACCGATGGGAAACTGAGAT
TGCAGAGAATCTGAGATCTGAXAAGCCTGTACCGCTGAGTTCTTTCGTCAGATATACACTGAAAACTCTTGCTTTTAAGAAATTCACAAA
ATAA\(3')AGGGATTTGGTGAATGTTATTATCGTTCCTTCCCTTGTCTTTTGATTGTTGGGATGGCTCTATTTCGTGTAGTACAAATTT
GTGAAATGAAATAGAGCGGAATCCTGGACGGATGCAGCTGTTTTAGAATTCTTGTATGCCGAGATGACTATTTGTGGAGTAACATCAATG
CTCTTAGACTTAAGTGGTTATCACTGCAATTATAATGAGTGTTTTACTTCCTGTTGCAATGAATTGAGGTGAGCTGCCCCTCTGTTTTTT
CTCTAAAAAAAAAAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan