ESTScan Details for Unigene SGN-U210296

Score 
176
Direction 
Forward
Predicted Peptide Sequence 
MLDLEEGSGTEENDTELLEKACTGEIPEDXQKIRDKWSYPESFAEQKWWSSXNLSAAPK
Predicted Coding Sequence 
ATGTTGGATCTGGAAGAGGGTTCAGGGACAGAGGAGAATGACACTGAATTGCTCGAGAAAGCCTGCACCGGAGAAATTCCAGAAGATXTG
CAGAAAATCCGAGACAAATGGAGTTATCCAGAATCATTTGCTGAGCAGAAATGGTGGTCTAGCAXTAATTTATCGGCGGCGCCAAAA\
Edits in Original Sequence 
GTTGTTTGTTAGGAATGCAGTTTCAGTCAGAGAAACTAACAGTCATCTGTACAATAATGGTTGTGATCTTTAGAACAATACGTTCACTCT
GATCATCATTCCAATTTCCATTAAGAAATCTATGCAAGAAAATTCTCAACCTTCACATACAAACTATTGCTATGTTTTTAGGAACATGGT
CTGCTCTTCCTCATCCAATTATGTAATTCGCCAAATCTGTTAGAAATGAGACTTTGTCAAGTTAGGAAGATGAGACTAAGTGAAACTATG
TCTATAGATTTCTTTGTGCTACTCATAAGTTGACAAATTTCTTGTACTAGCTTGATGCTTACTCTCTAAACTTTGTTTGCTCTTAAAGG
(5')ATGTTGGATCTGGAAGAGGGTTCAGGGACAGAGGAGAATGACACTGAATTGCTCGAGAAAGCCTGCACCGGAGAAATTCCAGAAGAT
XTGCAGAAAATCCGAGACAAATGGAGTTATCCAGAATCATTTGCTGAGCAGAAATaGGTGGTCTAGCAXTAATTTATCGGCGGCGCCAAA
A\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan